Registration Form : https://docs.google.com/forms/d/1QaaNa-NUHaV1fI_rV-d4nSfMT5RCCl4LCMzKzdD42vc

TBSC

Tishk Biology Scientific Competition / Question Bank

 

Biology Department

Tishk International University

 

1. Why does evaporation of water from a surface cause cooling of the surface?

1. 1. The breaking of bonds between water molecules absorbs heat,
   2. The water molecules with the most heat energy evaporate more readily,
   3. The solute molecules left behind absorb heat,
   4. Water molecules absorb heat from the surface in order to acquire enough energy to evaporate.

 

 

2. What are archaea?

1. Prokaryotes are characterized as extremophiles that share some bacterial and some eukaryotic traits,
2. Organisms that are adapted to high-temperature environments, such as volcanic springs,
3. Bacteria-like organisms that can live only in extreme salt environments,
4. Primitive protist-like creatures possessing fewer than two chromosomes per

 

 

3. Which of the following is the best description of the control for an experiment?

1. The control group is kept in an unchanging environment
2. The control is left alone by the experimenters,
3. The control group is matched with the experimental group except for the one experimental variable,
4. The control group is exposed to only one variable rather than

 

4. If a salamander relied on hydrogen bonds to cling to surfaces, what type of surface would cause the most problems for this animal?

1. A surface coated with a thin film of water,
2. A surface made with carbon and hydrogen atoms covalently bonded together,
3. A surface made with carbon, hydrogen, and oxygen atoms covalently bonded together,
4. A surface made with carbon, hydrogen, nitrogen, and oxygen atoms covalently bonded together.

5. What is the difference between covalent bonds and ionic bonds?

1. Covalent bonds are formed between atoms to form molecules; ionic bonds are formed between atoms to form compounds,
2. Covalent bonds involve the sharing of pairs of electrons between atoms; ionic bonds involve the sharing of single electrons between atoms,
3. Covalent bonds involve the sharing of electrons between atoms; ionic bonds involve the electrical attraction between atoms,
4. Covalent bonds involve the sharing of electrons between atoms; ionic bonds involve the sharing of protons between atoms.

6. In ammonium chloride salt (NH4Cl) the anion is a single chloride ion, Cl. What is the cation of NH4Cl?

1. N, with a charge of +1,
2. NH, with a charge of +1,
3. H3, with a charge of +1,
4. NH4, with a charge of +1.

7. The atomic number of chlorine is 17. The atomic number of magnesium is

12. What is the formula for magnesium chloride?
13. MgCl,
14. MgCl2,
15. Mg2Cl,

8. Research indicates that acid precipitation can damage living organisms by;

1. Buffering aquatic systems such as lakes and streams,
2. Decreasing the H+ concentration of lakes and streams,
3. Increasing the OH- concentration of lakes and streams,
4. Washing away certain mineral ions that help buffer soil solution and are essential nutrients for plant

9. Which of the following effects is produced by the high surface tension of water?

1. Lakes don’t freeze solid in winter, despite low temperatures,
2. A water strider can walk across the surface of a small pond,
3. Organisms resist temperature changes, although they give off heat due to chemical reactions,
4. Evaporation of sweat from the skin helps to keep people from

10. Prokaryotes are classified as belonging to two different domains. What are these domains?

1. Bacteria and Archaea,
2. Bacteria and Eukarya,
3. Archaea and Monera,
4. Eukarya and

11. Why does ice float in liquid water?

1. The high surface tension of liquid water keeps the ice on top,
2. The ionic bonds between the molecules in ice prevent the ice from sinking,
3. Ice always has air bubbles that keep it afloat,
4. Hydrogen bonds stabilize and keep the molecules of ice farther apart than the water molecules of the liquid

12. Which of the following is true of cellulose?

1. It is a polymer composed of enantiomers of glucose,
2. It is a storage polysaccharide for energy in plant cells,
3. It is digestible by bacteria in the human gut,
4. It is a major structural component of plant cell

13. Which of the following statements describes the function of the contractile vacuole?

1. It contains trapped bacteria to be digested by the lysosomes,
2. It contains the cell sap,
3. It eliminates excess water from the cytoplasm of freshwater protists,
4. It converts light energy to chemical

14. When Stanley Miller applied heat and electrical sparks to a mixture of simple inorganic compounds such as methane, hydrogen gas, ammonia, and water vapor, what compounds were produced?

1. Only simple organic compounds such as formaldehyde and cyanide,
2. Mostly hydrocarbons,
3. Only simple inorganic compounds,
4. Both simple organic compounds and more complex organic compounds such as amino acids and

15. Many mammals control their body temperature by sweating. Which property of water is most directly responsible for the ability of sweat to lower body temperature?

1. The absorption of heat by the breaking of hydrogen bonds,
2. Water’s changes in density when it condenses,
3. Water’s ability to dissolve molecules in the air,
4. The release of heat by the formation of hydrogen

16. A slice of pizza has 500 kcal. If we could burn the pizza and use all the heat to warm a 50-L container of cold water, what would be the approximate increase in the temperature of the water? (Note: A liter of cold water weighs about 1 kg.)

1. 50°C,
2. 5°C,
3. 10°C,
4. 100°C.

17. What determines whether a carbon atom’s covalent bonds to other atoms are in a tetrahedral configuration or a planar configuration?

1. The presence or absence of bonds with oxygen atoms,
2. The presence or absence of double bonds between the carbon atom and other atoms,
3. The polarity of the covalent bonds between carbon and other atoms,
4. The presence or absence of bonds with nitrogen at

18. There are 20 different amino acids. What makes one amino acid different from another?

1. Different side chains (R groups) are attached to a carboxyl carbon,
2. Different side chains (R groups) attached to the amino groups,
3. Different side chains (R groups) attached to a carbon
4. Different structural and optical Isom

19. Which of the following statements best describes the carbon atoms present in a seed-eating bird?

1. They were incorporated into organic molecules by plants,
2. They were processed into sugars through photosynthesis,
3. They were incorporated into organic molecules by plants, and they are ultimately derived from carbon dioxide,
4. They were incorporated into organic molecules by plants, they were processed into sugars through photosynthesis, and they are ultimately derived from carbon.

20. Humans can digest starch but not cellulose because;

1. The monomer of starch is glucose, while the monomer of cellulose is galactose,
2. Humans have enzymes that can hydrolyze the β glycoside linkages of starch but not the α glycoside linkages of cellulose
3. Humans have enzymes that can hydrolyze the α glycoside linkages of starch but not the β, glycoside linkages of cellulose
4. Humans harbor starch-digesting bacteria in the digestive

21. Mitochondria and chloroplasts have several common features; for example.

1. Neither are components of the endomembrane system,
2. Each contains a small amount of DNA,
3. Each organelle synthesizes some of its own protein,

22. A magnified picture of the detailed architecture of cell surfaces can best be obtained from a(n)

1. The scanning electron microscope,
2. The transmission electron microscope,
3. Light microscope,
4. Magnifying

23. Which of the following statements about the 5′ end of a polynucleotide strand of DNA is correct?

1. The 5′ end has a hydroxyl group attached to the number 5 carbon of ribose,
2. The 5′ end has a phosphate group attached to the number 5 carbon of ribose,
3. The 5′ end has phosphate attached to the number 5 carbon of the nitrogenous base,
4. The 5′ end has a carboxyl group attached to the number 5 carbon of

24. What do limits on maximum cell size depend on?

1. The number of organelles,
2. Surface-to-volume ratio,
3. Number of surrounding cells
4. Amount of DNA in the

25. Which of the following structures cannot be found in prokaryotic cells?

1. Flagella,
2. Cell membranes,
3. Mitochondria,
4. Ribosomes

26. Which of the following features do prokaryotes and eukaryotes have in common?

1. Mitochondria, cytoplasm, plasma membrane,
2. Ribosomes, plasma membrane, cytoplasm,
3. Nucleus, plasma membrane, ribosomes,
4. Mitochondria, ribosomes, cytoplasm.

 

 

 

 

27. Reduction of NADP+ occurs during:

1. Photosynthesis,
2. Respiration,
3. Both photosynthesis and respiration,
4. Neither photosynthesis nor

 

28.         Which one of the following is the most likely consequence for a cell lacking functional lysosomes?

1. The cell becomes crowded with undegraded wastes,
2. The cell dies because its ATP-synthesizing mechanisms are missing,
3. The cell dies from a lack of enzymes to catalyze metabolic reactions,
4. The cell is unable to reproduce

 

 

 

 

29.         In muscle cells the is/are specialized for the storage and release of calcium.

1. Mitochondria,
2. Smooth endoplasmic reticulum,
3. The Golgi apparatus,
4. Contractile

 

 

 

 

30.         Which of the following best describes the general structure of a cell membrane?

1. Proteins sandwiched between two layers of phospholipid,
2. Proteins embedded in two layers of phospholipid
3. A layer of protein coating a layer of phospholipid
4. Phospholipids sandwiched between two layers of

 

 

 

 

31.         Which of the following functional processes results from the presence of protein within the plasma membrane?

1. Enzymatic activity,
2. Intercellular joining,
3. Cell to cell communication,
4. All the

 

32.         The membrane is referred to as a “fluid mosaic” structure. Which of the following statements is true?

1. The fluid is phospholipid and the mosaic are protein,
2. The fluid is phospholipid and the mosaic are carbohydrate,
3. The fluid is protein and the mosaic are phospholipid,
4. The mosaic comprises the carbohydrate chains on the inner surface of the mem

 

 

33.         Phospholipids are well suited to serve as the major component of the plasma membrane because they .

1. Have a water-soluble part and a water-insoluble part,
2. Have very diverse structures and can act as receptors, enzymes, and channel molecules,
3. Contain protein,
4. All the

 

 

 

 

34.         Which of these statements describes what occurs in facilitated diffusion?

1. Facilitated diffusion is another name for osmosis,
2. Facilitated diffusion of solutes occurs through phospholipid pores in the membrane,
3. Facilitated diffusion requires energy to drive a concentration gradient,
4. Facilitated diffusion of solutes occurs through protein pores in the mem

 

 

 

 

35.         Which of the following is a difference between active transport and facilitated diffusion?

1. Facilitated diffusion can move solutes against a concentration gradient and active transport cannot,
2. Facilitated diffusion requires energy from ATP and active transport does not,
3. Active transport requires energy from ATP and facilitated diffusion does not,
4. Facilitated diffusion involves transport proteins and active transport does

 

 

36.         Which one of the following terms specifically refers to the intake of very large particles by cells?

1. Phagocytosis,
2. Exocytosis,
3. Osmosis,

 

 

 

 

37.         Where are the molecules of the electron transport chain found in plant cells?

1. Thylakoid membranes of chloroplasts,
2. Stroma of chloroplasts,
3. Outer membrane of mitochondria,
4. Cytoplasm.

 

 

 

 

 

 

 

 

 

 

38.         Which of the following are products of the light reactions of photosynthesis that are utilized in the Calvin cycle?

1. ATP and NADPH,
2. CO2 and glucose,
3. H2O and O2,
4. Electrons and H+.

 

 

 

 

39.         What does the chemiosmotic process in chloroplasts involve?

 

1. Establishment of a proton gradient,
2. Diffusion of electrons through the thylakoid membrane,
3. Reduction of water to produce ATP energy,
4. Formation of glucose, using carbon dioxide, NADPH, and

 

 

 

 

40.         When oxygen is released as a result of photosynthesis, it is a by-product of which of the following?

1. Reducing NADP+,
2. Splitting the water molecules,
3. Chemiosmosis,
4. The electron transfer system of photosystem

 

 

 

 

41.         A plant has a unique photosynthetic pigment. The leaves of this plant appear to be reddish yellow. What wavelengths of visible light are being absorbed by this pigment?

1. Red and yellow,
2. Blue and violet,
3. Green and yellow,
4. Blue, green, and

 

 

 

 

42.         Which of the following statements best describes the relationship between photosynthesis and respiration?

1. Respiration is the reversal of the biochemical pathways of photosynthesis,
2. Photosynthesis stores energy in complex organic molecules, while respiration releases it,
3. Photosynthesis occurs only in plants and respiration occurs only in animals,
4. Respiration is anabolic and photosynthesis is

 

43.         Which of the following statements is a correct distinction between autotrophs and heterotrophs?

1. Only heterotrophs require chemical compounds from the environment,
2. Cellular respiration is unique to heterotrophs,
3. Only heterotrophs have mitochondria,
4. Autotrophs, but not heterotrophs, can nourish themselves beginning with and other nutrients that are

 

 

 

 

44.         Where does the Calvin cycle take place?

1. Stroma of the chloroplast,
2. Thylakoid membrane,
3. Cytoplasm surrounding the chloroplast,
4. Chlorophyll m

 

 

 

 

45.         Synthesis of ATP by the chemiosmotic mechanism occurs during:

1. Only photosynthesis,
2. Only respiration,
3. Both photosynthesis and respiration,
4. Neither photosynthesis nor

 

 

 

 

46.         What is the primary function of the Calvin cycle?

1. Use ATP to release carbon dioxide,
2. Use NADPH to release carbon dioxide,
3. Split water and release oxygen,
4. Synthesizes simple sugars from carbon

 

 

47.         Which of the following sequences correctly represents the flow of electrons during photosynthesis?

1. NADPH O2 CO2,
2. H2O NADPH Calvin cycle,
3. H2O chlorophyll   Calvin cycle,
4. NADPH electron transport chain O2,

 

 

48.         Which of the following does not occur during the Calvin cycle?

1. Carbon fixation,
2. Oxidation of NADPH,
3. Release of oxygen,
4. Consumption of

 

 

 

 

 

 

 

 

 

 

49.         Which process is most directly driven by light energy?

1. Carbon fixation in the stroma,
2. Reduction of NADP molecules,
3. Removal of electrons from chlorophyll molecules,
4. ATP

 

 

 

 

50.         Energy from sunlight is trapped by chlorophyll located in the        .

1. Citric acid cycle,
2. Mitochondria,

 

1. Electron transport chain,
2. Thylakoid mem

 

 

 

 

51.         Which one of the following is an example of the second law of thermodynamics?

1. The aerobic respiration of glucose generates heat,
2. All types of cellular respiration produce ATP,
3. CO2 is exhaled as a by-product of aerobic respiration,
4. Photosynthesis enables plants to create energy from su

 

 

 

 

52.         If the entropy of a system is increasing, this means that      .

1. The sun’s energy is being captured by photosynthesis,
2. Heat is being used by organisms as a source of energy,
3. The first law of thermodynamics is being violated,
4. Energy input will be needed to maintain

 

 

 

 

53.                         is an example of the cellular work accomplished with the free energy of ATP hydrolysis.

1. Mechanical work, such as the beating of cilia,
2. Transport work, such as the movement of glucose into an adipose cell,
3. Chemical work, such as the synthesis of new protein,
4. All of the

 

 

54.         What must be true if the reaction AB + CD —> AC + BD occurs spontaneously?

1. The reaction must be exergonic,
2. The environment has adequate thermal energy to meet the activation energy requirement,

 

1. The bonds must have absorbed enough energy to become unstable,
2. All of the

 

 

 

 

55.         Enzymes can, but they cannot because they cannot .

1. Greatly speed up reactions … change the net energy output … change the activation energy,

b.                 Change the equilibrium point of reactions … speed up reactions … change the net energy output,

1. Lower the activation energy of reactions … change the equilibrium point … change the net energy output,
2. Greatly speed up reactions … change the activation energy … change the net energy output.

 

 

 

 

56.         Which one of the following tells us, without additional information, the way a process will go spontaneously?

1. ∆G,
2. ∆H,
3. ∆S,
4. T∆S.

 

 

 

57.         A competitive inhibitor competes with the at the of an enzyme.

1. Product … active site,
2. Product … allosteric site,
3. Substrate … active site,
4. Substrate … allosteric

 

58.      In an enzyme molecule with multiple subunits, the binding of one substrate molecule to the active site of one subunit causes all the subunits to assume their active conformation, via the mechanism of induced fit. This is called:

1. Allosteric activation,
2. Allosteric inhibition,
3. Cooperativity,
4. Competitive

 

 

 

 

 

 

 

 

 

 

59.  The process of stabilizing the quaternary structure of an enzyme in its active form by the binding of a molecule is an example of .

1. Feedback inhibition,
2. Competitive inhibition,
3. Allosteric regulation,
4. The participation of a co-factor.

 

 

 

 

 

60.         Most of the ATP produced in cellular respiration comes from         .

1. Glycolysis,
2. Chemiosmosis,
3. Biosynthesis,
4. The Krebs

 

61.         A chemist has discovered a drug that blocks phosphoglucoisomerase, an enzyme that catalyzes the second reaction in glycolysis. He wants to use the drug to kill bacteria in people with infections. But he can’t do this because;

1. Bacteria are facultative anaerobes; they usually don’t need to perform glycolysis,
2. Glycolysis produces so little ATP that the drug will have little effect,
3. Human cells also perform glycolysis; the drug might also poison them,
4. Glycolysis can occur without the action of enzym

 

 

 

 

 

62.         Of the following molecules in the glycolytic pathway (the process of glycolysis), the one with the most chemical energy is       .

1. Pyruvate,
2. Fructose-6-phosphate,
3. Fructose-1,6-bisphosphate,
4. Glyceraldehyde-3-phosphate.

 

 

 

 

63.         When pyruvate is converted to acetyl CoA:

1. CO2 and ATP are formed,
2. CO2 and NADH are formed,
3. CO2 and coenzyme A are formed,
4. (Oxidized) NAD is

 

 

64.         In preparing pyruvate to enter the Krebs cycle, which of the following steps does NOT occur?

1. It is oxidized by reducing an NAD+ to an NADH,
2. A compound called coenzyme A binds to a two carbon fragment,
3. Oxygen must be present for the pyruvate to enter the Krebs cycle,

 

1. The two-carbon fragment formed after a carbon atom is released as carbon dioxide is called lactate.

 

 

 

 

 

65.         How many ATPs are gained by substrate-level phosphorylation from the complete breakdown of a single molecule of glucose in the presence of oxygen?

1. 2 ATP,
2. 4 ATP,
3. 6 ATP,
4. 38

 

 

 

 

 

66.         The enzyme ATP synthase forms ATP   .

1. Due to the potential energy of a concentration gradient of hydrogen ions across a membrane,
2. Due to substrate-level phosphorylation,
3. From glucose in the absence of oxygen,
4. In the absence of chemiosm

 

 

 

 

 

67.         During aerobic respiration, molecular oxygen (O2) is used:

1. At the end of the Krebs cycle to cycle back to citric acid,
2. Between glycolysis and the Krebs cycle to split a carbon from pyruvate
3. Between the Krebs cycle and the electron transport chain to move NADH and FADH2,
4. D. At the end of electron transport chain to accept electrons and form H2O.

 

68.         Which of the following features do prokaryotes and eukaryotes have in common?

1. Mitochondria, cytoplasm, plasma membrane,
2. Ribosomes, plasma membrane, cytoplasm,
3. Nucleus, plasma membrane, ribosomes,
4. Mitochondria, ribosomes, cytoplasm.

 

 

 

 

69.         In muscle cells the is/are specialized for the storage and release of calcium.

1. Mitochondria,
2. Smooth endoplasmic reticulum,
3. The Golgi apparatus,
4. Contractile

 

 

 

 

70.         Membrane proteins are synthesized by ribosomes that are attached to .

1. The Golgi apparatus,
2. Mitochondria,
3. The nucleolus,
4. The endoplasmic reticulum.

 

 

 

 

71.         Which one of the following is the most likely consequence for a cell lacking functional lysosomes?

1. The cell becomes crowded with undegraded wastes,
2. The cell dies because its ATP-synthesizing mechanisms are missing,
3. The cell dies from a lack of enzymes to catalyze metabolic reactions,
4. The cell is unable to reproduce

 

 

 

 

72.         Which of the following statements describes the function of the contractile vacuole?

1. It contains trapped bacteria to be digested by the lysosomes,
2. It contains the cell sap,
3. It eliminates excess water from the cytoplasm of freshwater protists,
4. It converts light energy to chemical

 

 

73.         Which of these statements describes what occurs in facilitated diffusion?

1. Facilitated diffusion is another name for osmosis,
2. Facilitated diffusion of solutes occurs through phospholipid pores in the membrane,
3. Facilitated diffusion requires energy to drive a concentration gradient,
4. Facilitated diffusion of solutes occurs through protein pores in the mem

 

 

 

 

74.         Which of the following is a difference between active transport and facilitated diffusion?

1. Facilitated diffusion can move solutes against a concentration gradient and active transport cannot,
2. Facilitated diffusion requires energy from ATP and active transport does not,
3. Facilitated diffusion involves transport proteins and active transport does not,
4. Active transport requires energy from ATP and facilitated diffusion does

 

 

 

 

75.         Which of these statements is TRUE about cholesterol metabolism?

1. Cholesterol circulates in the blood and is deposited on blood vessels,
2. Cholesterol is formed because it is a waste product of fat metabolism,
3. The kidneys maintain cholesterol balance,
4. Cholesterol is dangerous because it creates layers of fat in the heart m

 

 

 

 

76.         According to the second law of thermodynamics, which of the following is TRUE?

1. Energy conversions increase the order in the universe,
2. The total amount of energy in the universe is constant,
3. The ordering of one system depends on the disordering of another,
4. The entropy of the universe is constantly

 

 

77.         Energy is most commonly stored in plants as

.

1. Electrical energy,
2. Mechanical energy,
3. Kinetic energy,
4. Chemical

 

 

 

 

78.         Which one of the following has the freest energy per molecule?

1. A sugar molecule,
2. An amino acid molecule,
3. A starch molecule,
4. A fatty acid m

 

 

 

 

79.         Which of the following reactions would be endergonic?

1. HCl —> H+ + Cl-
2. C6H12O6 + 6O2 —> 6CO2 + 6H2O,
3. ATP —> ADP + Pi,
4. Maltose + fructose —> Sucrose.

 

 

 

 

 

 

80.         Which of the following statements about enzymes is TRUE?

1. Enzymes raise the activation energy for reactions,
2. Enzymes react with substrates (form chemical bonds) to form an enzyme-substrate complex, which irreversibly alters the enzyme,
3. Most enzymes are chains of amino acids,
4. Only the most efficient enzymes can catalyze reactions in either

 

 

 

 

 

81.         Enzymes can, but they cannot

because they cannot .

1. Greatly speed up reactions … change the net energy output … change the activation energy,
2. Change the equilibrium point of reactions … speed up reactions … change the net energy output,
3. Greatly speed up reactions … change the activation energy … change the net energy output,
4. Lower the activation energy of reactions … change the equilibrium point … change the net energy

 

 

82.         Most of the ATP produced in cellular respiration comes from         .

1. Glycolysis,
2. Chemiosmosis,
3. Lactic acid fermentation,

 

83.         In cellular respiration,       is oxidized and

is reduced.

1. Oxygen … ATP,
2. ATP … Oxygen,
3. Glucose … Oxygen,
4. Carbon dioxide …

 

 

 

 

 

84.         Which one of the following best describes the electron transport chain?

1. Electrons are pumped across a membrane by active transport,
2. Acetyl CoA is fully oxidized to CO2,
3. Hydrogens are added to CO2 to make an energy- rich compound,
4. Electrons pass from one carrier to another, releasing a little energy at each

 

 

 

 

85.         During the cellular respiration in a eukaryotic cell, reactions of glycolysis occur, or are located, in or on   .

1. The cytosol,
2. The matrix of the mitochondrion,
3. The cristae of the mitochondrion,
4. The intermembrane space of the m

 

 

 

 

 

86.         Fermentation is essentially glycolysis plus an extra step in which pyruvate is reduced to form lactate or alcohol and carbon dioxide. This last step    .

1. Removes poisonous oxygen from the environment,
2. Extracts a bit more energy from glucose,

 

1. Enables the cell to recycle NAD+,
2. Inactivates toxic

 

 

 

 

 

 

 

 

 

 

87.         When pyruvate is converted to acetyl CoA.

1. CO2 and ATP are formed,
2. CO2 and NADH are formed,
3. CO2 and coenzyme A are formed,
4. One turn of the Krebs cycle is com

 

 

 

 

88.         Muscle tissues make lactate from pyruvate in order to        .

1. Enable you to get drunk,
2. Get rid of toxic pyruvate,
3. Utilize the energy in pyruvate,
4. Regenerate (oxidized) NAD+.

 

 

 

 

89.         When protein molecules are used as fuel for cellular respiration, are produced as waste.

1. Amino groups,
2. Fatty acids,
3. Sugar molecules,
4. Molecules of

 

 

90.         When yeast cells undergo fermentation or anaerobic respiration the products are:

1. Carbon dioxide and water,
2. Glucose and oxygen,
3. Carbon dioxide and ethanol,
4. Lactic acid and

 

 

 

 

91.         Which of the following three structures in a cell are visible with a standard compound light microscope?

1. Nucleus, chloroplast, Golgi apparatus,
2. Mitochondrion, centriole, vacuole,
3. Ribosome, lysosome, endoplasmic reticulum,
4. Chloroplast, vacuole,

 

 

 

 

92.  A cell biologist would like to observe the process of mitosis in a plant cell. Which of the following would you advise cells be taken from?

1. The middle part of a stem,
2. A root tip,
3. Pollen grains,
4. A

 

 

93.         Which of the following isotopes would be the most logical to use to study the dark reactions (Calvin cycle) of photosynthesis?

1. 3H,
2. 35S,
3. 14C,

 

 

 

 

 

 

94.         Which of the following cellular organelles is mis-matched with function?

1. Golgi apparatus – amino acid synthesis,
2. Endoplasmic reticulum – protein synthesis,
3. Mitochondrion – generation of ATP,
4. Nucleolus – Ribosome

 

 

 

 

 

95.         When light strikes chlorophyll molecules in a photosynthetically active chloroplast, they lose electrons. What is the ultimate source of replacement electrons?

1. Water,
2. Carbon dioxide,
3. Glucose,
4. Reduction of

 

 

 

 

96.         Which of the following diet compositions will allow an animal to gain the most energy assuming an equal mass of each is consumed?

1. 90% sugar, 5% protein and 5% water,
2. 90% protein, 5% sugar and 5% water,
3. 90% fat, 5% protein and 5% water,
4. 50% sugar, 10% protein and 40%

 

 

97.         The two molecules shown in the figure above are best described as:

1. Enantiomers,
2. Radioactive isotopes,

 

1. Structural isomers,
2. Cis-trans isom

 

 

 

 

 

 

 

 

 

 

98.         Which of the following are involved in the process of photosynthesis? I Splitting of water.

II Splitting of light.

Ill Production of carbon dioxide.

1. I only,
2. I and II,
3. II and III,
4. I, II and

 

99.         Based on your knowledge of the polarity of water molecules, the solute molecule depicted here (the shape) is most likely;

1. Positively charged,
2. Negatively charged,
3. Without charge,

 

 

 

 

100.      Ozone in the atmosphere:

1. Leads to formation of acid precipitation,
2. Combines readily with water vapor,
3. Absorbs harmful radiation from the sun,
4. All of the

 

 

 

 

101.      Gene flow is a concept best used to describe an exchange between:

1. Species,
2. Populations,
3. Community,

 

 

 

 

 

102.      According to the competitive exclusion principle, two species cannot continue to occupy the same:

1. Niche,
2. Territory,
3. Range,
4. Biom

 

 

103.      The five levels of organization in the environment, from first to fifth level are:

1. Organism, population, biosphere, ecosystem, community,
2. Organism, population, biotic elements, abiotic elements, community,
3. Organism, population, community, ecosystem, biosphere,
4. Organism, population, biosphere, abiotic elements,

 

 

 

 

104.  A community is several species of animals interacting, while a population is:

1. Members of one species in an area,
2. The biotic and abiotic elements of an area,
3. The nonliving elements of a habitat,
4. A single organism.

 

 

 

 

105.      Grass is eaten by a prairie dog. The prairie dog is eaten by a coyote. This is an example of;

1. An abiotic element,
2. An herbivore,
3. An omnivore,
4. A food

 

 

 

 

106.      Which of these is the smallest unit upon which natural selection directly acts?

1. A species’ gene frequency,
2. An individual’s phenotype,
3. An individual’s genome,
4. An individual’s

 

 

 

 

107.      One food web arrow goes from a prairie dog to a coyote, showing that:

1. The coyote is bigger,
2. The coyote eats the prairie dog,
3. The prairie dog eats the coyote,
4. The prairie dog is a

 

 

 

 

108.      Destruction of the tropical rain forests:

1. Threatens the existence of thousands of species,
2. Provides for more pasture and farmlands,
3. Is done partly because of the need for lumber,
4. All of the

 

 

 

 

 

 

 

 

 

 

109.      The largest population an environment can support is its:

1. Carrying capacity,
2. Population,
3. Limiting factor,
4. Sym

 

 

 

 

110.      One type of competition involves individuals competing for resources. The other involves competition between different:

 

1. Organisms,
2. Environments,
3. Populations,

 

 

 

 

111.      Which of the following is part of the nitrogen cycle?

1. Conversion of atmospheric nitrogen into usable organic compounds by bacteria,
2. Conversion of nitrogen from decaying organisms into ammonia,
3. Nitrogen fixation,
4. All of the

 

 

 

 

112.      Young wasps are eating the tomato hornworm that is their host. What is this an example of?

1. Commensalism,
2. Parasitism,
3. Mutualism,
4. Com

 

 

 

 

113.      Which is an example of an abiotic element changing an area?

1. Introducing a new type of grass,
2. Water flooding the area,
3. Two species of birds competing,
4. Algae growing on

 

 

 

 

114.      In a food web arrows point in just one direction because they show:

 

1. Which animal is bigger,
2. Which animals are related,
3. How energy goes to the animal that is eating,
4. How energy goes to the animal that is

 

 

115.      The decrease in species diversity of some lakes in the northeastern United States during the 20th century may best be explained by;

1. Global warming,
2. The destruction of the ozone layer,
3. Evolutionary trends,
4. Acid

 

 

 

 

116.      In the upper atmosphere, sulfur released from the burning of sulfur-rich coal combines with water vapor to form:

1. Sulfur dioxide,
2. Sulfuric acid,
3. Ozone,
4. All of the

 

 

 

 

117.      The greenhouse effect may increase on Earth because:

1. Decomposers essential to recycling matter are being destroyed,
2. Too much oxygen is now given off by plants,
3. Increasing carbon dioxide will trap more heat,
4. Earth tilts toward the sun in the summ

 

 

 

 

118.      Solar energy can be trapped in the atmosphere by;

 

1. The chemical bonds of carbon dioxide,
2. Radiation,
3. Ozone,

 

 

 

 

119.      It is far more common to find human genetic disease caused by…………. alleles

than by……………..alleles because……………….

1. Dominant … recessive…. dominant alleles have an evolutionary advantage over recessive

alleles,

1. Dominant … recessive…. dominant alleles became dominant because they aid the survival

of the organism carrying them,

1. Recessive … dominant…. harmful recessive alleles can survive in the heterozygote without

any selection pressure against them,

1. Recessive … dominant…. even when homozygous, recessive alleles usually do not cause

as much damage as dominant alleles.

 

 

 

 

 

 

 

 

120.      Refer to the illustration. According to the graph:

1. There were no humans on Earth around 6000 BCE,
2. The human population has never decreased in size,
3. An increase in the food supply was responsible for the increase in the population,
4. The human population is currently rising dram

 

 

 

 

 

 

 

 

121.      Refer to the illustration above. According to the graph, the human population:

1. Remained essentially unchanged for thousands of years,
2. Doubled in size between 4000 and 1000 years ago,
3. Reached 1 billion in 1492,
4. Will stop growing in the year

 

 

 

 

122.      In ammonium chloride salt (NH4Cl) the anion is a single chloride ion, Cl. What is the cation of NH4Cl?

1. N, with a charge of +1,
2. NH, with a charge of +1,
3. H3, with a charge of +1,
4. NH4, with a charge of +1.

 

 

 

 

123.      What is the first step in solving an environmental problem?

1. Risk analysis,
2. Assessment,
3. Political action,
4. Public

 

 

1. c. With one another and their physical environment.
2. And the food they eat.

 

 

 

 

 

 

124.  In a diploid set of chromosomes, one of each pair of homologous chromosomes is derived from the father (paternal), the other of each pair from the mother (maternal). If 2n = 8, what is the probability of obtaining a gamete in which all the chromosomes are paternal ones?

1. 1/8,
2. 1/16,
3. 1/32,
4. d. Cannot be determined from these data.

 

 

 

 

125.  A karyotype is .

1. A means of determining a person’s phenotype,
2. All the possible gametes a person could produce,
3. A photograph of a person’s all chromosomes,
4. A list of all the genes a person

 

 

 

 

 

126.      Spores and gametes are different in that

1. Gametes are always haploid while spores are diploid,
2. Gametes can fuse to form a zygote, but spores can develop into independent organisms without forming a zygote,
3. Some gametes are motile, but no spores can move independently,
4. Gametes are derived directly from sporophytes to form gam

 

 

 

 

 

 

127.      It was important that Mendel chose true- breeding varieties for his experiments because;

1. True-breeding varieties are ALWAYS heterozygous for the trait of interest,
2. True-breeding varieties are NEVER heterozygous for the trait of interest,
3. True-breeding varieties are easier to crosspollinate,
4. True-breeding varieties are NEVER homozygous for the trait of

 

 

 

 

 

128.      John and Jane are planning a family, but since each has a brother who has sickle-cell disease, they are concerned that their children may develop sicklecell disease. Neither John, Jane, nor their respective parents have the disease. They consult a genetic counselor who tells them that           .

1. There is no chance that any of their children will have sickle-cell disease,
2. All of their children will have sickle-cell disease,
3. One of four of their children can be expected to have sickle-cell disease,
4. It’s possible that none of their children will have the disease, but blood tests on them both will be required to make

 

 

 

 

129.      Fetal cells may be removed along with fluid from the womb by a process known as        .

1. Amniocentesis,
2. Uterine tapping,
3. Sonogramming,
4. Chorionic villus sam

 

 

130.      Four genes (A, B, C, and D) are on the same chromosome. The crossover frequencies below are obtained.

AB 19%           B-C 14%          A-C 5%

B-D 2%A-D 21%          C-D 16%

Which is the correct sequence of genes?

1. ABCD,
2. ABDC,
3. ACBD,

 

 

131.      During meiosis, homologous chromosomes sometimes “stick together” and

do not separate properly. This phenomenon is known as    .

1. Meiotic failure,
2. Gametic infertility,
3. Nondisjunction,
4. Sticky chiasm

 

 

 

 

 

132.      Several inherited disorders are much more common in close-knit religious communities, such as the Amish, than in the general population. This is at least partly due to the fact that .

1. People in such communities are more likely to marry relatives,
2. Shared environmental conditions such as diet can increase mutation rate,
3. Modern medical care is not widely available in such communities,
4. Comm members care for each other, and such disorders are contagious.

 

133.      An AABbCcDd individual is mated with another AABbCcDd individual. The possible number of genetically different kinds of offspring is .

 

a.	9,
b.	8,
c. 27,
d. 81.

 

 

 

 

 

134. Why are individuals with an extra chromosome 21, which causes Down syndrome, more numerous than individuals with an extra chromosome 3 or chromosome 16?
135. There are probably more genes on chromosome 21 than on the others,
136. Down syndrome is not more common, just more serious,
137. Extra copies of the other chromosomes are probably fatal,
138. Nondisjunction of chromosomes 3 and 16 probably occurs more

 

 

 

 

 

 

 

 

 

 

135 .A red bull is crossed with a white cow and all of the offspring are roan, a shade between red and white. This is an example of genes that are

.

1. Hypostatic,
2. Epistatic,
3. Co-dominant,
4. Incompletely dom

 

 

 

 

136.      The DNA structures of prokaryotes and eukaryotes are different in several ways, but one way in which these two DNAs are the same is that .

1. Both have a sugar-phosphate backbone,
2. Histones are present in the nucleosomes,
3. Most of the DNA is in the form of plasmids,
4. Both have a single circular chromosom

 

 

 

 

 

137.      Which one of the following is the only known viable human monosomy?

1. XYY,
2. XO,
3. YO,

 

 

 

 

 

138.      A point mutation in which a single base pair is inserted or deleted from DNA is called a(n)

.

1. Nonsense mutation,
2. Frame – shift mutation,
3. Inversion mutation,
4. Translocation m

 

139.      During translation, amino acid chain elongation occurs until         .

1. No further amino acids are needed by the cell,
2. The ribosome runs off the end of the mRNA strand,
3. The polypeptide is long enough,
4. The ribosome encounters “stop”

 

 

140.      It is proposed that a certain malformation of the inner ear is controlled by mitochondrial DNA. Which of the following observations would be the most decisive evidence AGAINST this idea?

1. Fathers with the malformation pass it on to all their children, but mothers with the malformation do not pass it along,
2. Females and males have the malformation in equal numbers,
3. The incidence of the disease is irregular, affecting some offspring severely but most not at all,
4. Mothers pass the disease on to their offspring, but fathers do

 

 

 

 

141.      Genetic mutations .

1. Occur spontaneously,
2. Are most common in body parts that are not used very often,
3. Are most common in body parts that are used frequently,
4. Are mainly caused by diseases associated with fetal developm

 

 

 

 

 

142.      How does a bacterial chromosome differ from a eukaryotic chromosome?

1. A bacterial chromosome is a circular, double- stranded DNA molecule with associated proteins. A eukaryotic chromosome is a linear, double-stranded DNA molecule with many associated proteins, including histones,
2. A bacterial chromosome is a circular, double- stranded DNA molecule with associated histone A eukaryotic chromosome is a linear, double-stranded DNA molecule with many associated proteins,

 

1. A bacterial chromosome is a linear, double- stranded DNA molecule with many associated proteins. A eukaryotic chromosome is a circular, double-stranded DNA molecule with very few attached protein molecules,
2. A bacterial chromosome has a circular, double- stranded DNA m A eukaryotic chromosome has a circular, double-stranded DNA molecule with many associated proteins.

 

 

 

 

 

 

 

 

143.      Which arrangement of the following four enzymes represents the order in which they would be used in a typical gene-cloning experiment resulting in the insertion of a foreign gene into a bacterial plasmid? Begin with the gene’s mRNA transcript.

1. Restriction enzyme, reverse transcriptase, DNA polymerase, DNA ligase,
2. Reverse transcriptase, DNA polymerase, restriction enzyme, DNA ligase,
3. Restriction enzyme, DNA ligase, reverse transcriptase, DNA polymerase,
4. Reverse transcriptase, DNA ligase, DNA polymerase, restriction enzym

 

 

 

 

 

 

 

144.      How do retroviruses such as HIV differ from other viruses?

1. They have much simpler reproductive cycles than other RNA viruses,
2. They contain DNA that is used as a template to make RNA,
3. They can reproduce only inside living cells,
4. They contain the enzyme reverse

 

 

145.      Which of the following is true of gene regulation in both eukaryotes and prokaryotes?

1. Gene regulation in both prokaryotes and eukaryotes involves the elaborate packing of DNA in chromosomes,
2. Gene regulation in both prokaryotes and eukaryotes involves the addition of a cap and a tail to mRNA after transcription,
3. Gene regulation in both prokaryotes and eukaryotes involves lac and trp operons,
4. Gene regulation in both prokaryotes and eukaryotes involves the removal of noncoding portions of RNA from the RNA

 

 

 

 

146.   Methane is a “greenhouse gas” that traps 25 times more heat than CO2 and is thought to significantly contribute to global warming. Up to 12% of the food energy consumed by a cow is converted in the cow’s gut to methane and released to the

atmosphere when the cow burps or farts (passes gas). Scientists have found that if a cow is fed an antibiotic, the amount of methane released by the cow is reduced.

They also found that samples of food from the cow’s stomach produce methane if put in a sealed container without air, but do not produce methane if air is bubbled through the mixture. When they heat the mixture above 100°C, methane production stops. What is the most likely explanation of these observations?

1. Methane is produced by the action of the cow’s digestive enzymes, and these enzymes are

inhibited by the presence of oxygen,

1. Methane is produced by bacteria in the cow’s gut through an anaerobic process involving enzymes,
2. Methane is produced by a non-biological chemical reaction that is inhibited by the presence of oxygen,
3. The antibiotic introduced air into the cow’s gut

that destroyed the methane, which is unstable in

1. the presence of oxygen or when

 

147.   Evaporative cooling is a process whereby (1) moving……………………… (2)

……………………molecules vaporize, thus…………………………. (3) large amounts of heat.

(Fill in the blanks from the following table).

 

148. Which of the following processes absorb free energy (i.e., are endergonic)?
149. Nitrogen fixation
150. Respiration

• Photosynthesis

1. Maintenance of homeostasis
2. i and ii,
3. iii and iv,
4. ii and iv,
5. i, iii, and

 

 

 

 

 

149.      Which term best describes the relationship between the chemical reactions illustrated below?

ATP + H2O    ADP + Pi + energy

Glucose + Pi + energy        Glucose-6-phosphate

+ H2O

1. Coupled phosphate transfer reactions,
2. Coupled redox reactions,

 

1. Chemiosmotic synthesis of ATP,
2. Coupled electron transport

 

 

 

 

150.      The membrane illustrated above (at time zero, and again after two hours) allows molecules to pass through it according to what criterion?

1. Temperature of the solution,
2. Electric charge of the molecules,
3. Size of the molecules,
4. Concentration of the

 

 

 

 

 

 

 

 

 

 

151.      People on low carbohydrate diets derive their energy primarily

from stored fats. Which of the following is the key metabolic pathway that allows to produce cellular energy from lipids?

1. The breakdown of lipids to glucose (glycolysis),
2. The breakdown of lipids to lactic acid (lactic acid fermentation),
3. The breakdown of lipids to acetyl-CoA (beta- oxidation),
4. The breakdown of lipids to alpha-ketoglutarate (deamination).

 

 

152.   Which statement is CORRECT?

1. Chloroplasts and mitochondria both produce ATP through the process of chemiosmosis,
2. Animal cells have mitochondria and no chloroplasts; plant cells have chloroplasts and no mitochondria,

 

1. Energy is produced in the mitochondrion in the form of ATP and does not involve an electron transport chain; energy produced in the chloroplasts involves a light-activated electron transport chain,
2. Oxygen is released by the Calvin cycle during

 

 

153.      Match the component or process in the left column with the proper compartment or membrane in the right column (e.g., the citric acid cycle occurs within the         ).

1. i-q, ii-p, iii-s, iv-r
2. i-q, ii-s, iii-r, iv-p
3. i-r, ii-s, iii-p, iv-q
4. i-p, ii-s, iii-q, iv-r

 

 

 

154.      Which statement about structures found within cells is CORRECT?

1. The chloroplast is surrounded by a single membrane, whereas the mitochondrion is surrounded by a double membrane,
2. Mitochondria and chloroplasts contain DNA and ribosomes,
3. Actin filaments (microfilaments) are found in plant cells on the outside of the cell membrane,
4. Peroxisomes contain enzymes that break down long chains of

 

155.  A student looked at a slide of stained onion cells and found one where the chromosomes looked X-shaped and were scattered over the nuclear area. The cell was in:

1. G1 phase of the cell cycle,
2. Prophase,
3. Metaphase,

 

 

 

 

 

156.      Which statement is NOT consistent with the fluid-mosaic model of cell membranes?

1. Proteins float in a phospholipid bilayer,
2. Hydrophilic proteins are always anchored in the membrane,
3. Lipid bilayers can fuse with other bilayers,
4. Temperature can affect the fluidity of the mem

 

 

 

 

 

As a class experiment, students added a chemical to elongated protist cells as they watched them under the microscope. The cells became spherical and organelles within the cells stopped streaming through the cytoplasm.

157. What structure was most likely directly affected by the chemical?
     1. Cell wall,
     2. Cytoskeleton,
     3. Cell membrane,

 

 

 

 

158.      Which events occur during the light reactions of photosynthesis?

 

1. Fixation of carbon dioxide, reduction of NADP+, formation of ATP,
2. Oxidation of water, reduction of NADP+, formation of ATP,
3. Oxidation of water, reduction of NADP+, hydrolysis of ATP,
4. Fixation of carbon dioxide, release of oxygen, synthesis of

 

 

 

 

159.      What are the products of one molecule of glucose undergoing cellular respiration?

1. Two molecules of pyruvate in the cytoplasm and two molecules of water in the mitochondrion,
2. Two molecules of pyruvate and two molecules of water in the cytoplasm,
3. One molecule of pyruvate in the mitochondrion and one molecule of water in the cytoplasm,
4. One molecule of pyruvate in the cytoplasm and one molecule of water in the m

 

 

 

 

 

160.      In single-celled animals, which organelle is primarily responsible for digesting food particles?

1. Golgi apparatus,
2. Lysosome,
3. Endoplasmic reticulum,

 

 

 

 

 

161.      Which statement about respiration is FALSE?

1. Oxidation of pyruvate produces acetyl-CoA (the two-carbon molecule) and is the link between glycolysis and the citric acid cycle (Krebs cycle),

 

1. During the citric acid cycle the four-carbon molecule oxaloacetate is added to acetyl-CoA to form citric acid,
2. The electron transport chain pumps protons out of the intermembrane space and into the mitochondrial matrix,
3. In eukaryotes, the actual yield of ATP through aerobic respiration is lower than the theoretical yield partly because mitochondria use the proton gradient for purposes other than ATP synthesis.

 

 

162.      Why is photosynthetic CO2 fixation dependent on light?

1. ATP and NADPH are required for the regeneration of ribulose bisphosphate (RuBP),
2. The conversion of RuBP and CO2 to 3- phosphoglycerate (3PG) requires ATP,
3. Phosphoenolpyruvate (PEP) regeneration requires NADPH,
4. The movement of CO2 from the air into the leaf requires

 

 

 

 

 

163.      Which of the following describes the defining difference between eukaryotic cells and prokaryotic cells?

1. Eukaryotic cells have cilia, while prokaryotic cells have pili,
2. Eukaryotic cell walls consist of carbohydrates, while prokaryotic cell walls consist of carbohydrates and peptides,
3. Eukaryotic cells have membrane-enclosed genetic material, while prokaryotic cells do not,
4. Eukaryotic cells are autotrophic or heterotrophic, while prokaryotic cells are only heterotrophic.

 

 

 

 

 

164.      Organisms that live in hypotonic aqueous environments must overcome which problem?

1. Water and salt loss,
2. Loss of water only,
3. Loss of salts only,

 

1. Dilution and loss of

 

 

 

 

165.  A cell in the G1 phase has two homologous pairs of chromosomes. It undergoes a mitotic division, followed by meiosis. At the end of meiosis 2, what is the sum of all the products of these divisions in all cells?

1. 16 chromosomes, 16 chromatids, 8 cells, 4 times as many alleles,
2. 8 chromosomes, 16 chromatids, 8 cells, 2 times as many alleles,
3. 8 chromosomes, 16 chromatids, 16 cells, 4 times as many alleles,
4. 16 chromosomes, 16 chromatids, 4 cells, 4 times as many

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Some species of ants’ guard plants where aphids feed, preventing other potential predators from attacking the aphids. The aphids excrete a sweet fluid that the guard ants feed on.

166. What term best describes this relationship between the guard ants and aphids?
167. Mutualism,
168. Parasitism,
169. Commensalism,

 

 

 

 

167.      Which of the following is the best example of a density-independent effect?

1. The spread of avian flu in commercial chicken farms,
2. The population cycles of Lynx (predator) and

Hare (prey) in Canada’s boreal forest,

1. The population decline in birds of prey due to water pollution,
2. The increase in water clarity in the Great Lakes resulting from the invasion of filter-feeding zebra m

 

 

 

 

 

168.      Which of the following is LEAST likely to result from the effects of global climate change?

1. A lowering of ocean levels will result in the destruction of coral reefs and coastal habitats,
2. An increase in the frequency of severe storms,
3. An increase in drought in parts of North America,
4. Increased

 

 

 

 

 

A naturalist studying competitive interactions between flower-visiting animals in a meadow observes that hummingbirds always prevent butterflies from feeding on blue flowers.

169. What would most likely occur upon removal of hummingbirds from the meadow?
170. An increase in the fundamental niche of butterflies,
171. A decrease in the realized niche of butterflies,
172. A decrease in the fundamental niche of butterflies,
173. An increase in the realized niche of

 

 

170.      Which of the following species interactions, which one does NOT reduce population size?

1. Commensalism,
2. Predation,
3. Competition,
4. Brood parasitism.

 

 

 

 

 

171.      Which of the following is an example of primary succession?

1. Soil formation in the crater of an extinct volcano,
2. Growth of a jack pine forest after a major forest fire,
3. Restoration of a tall grass prairie ecosystem on a former wheat field,
4. Spruce trees growing on land after logging companies have clear-cut the original

 

 

 

 

 

172.      Which of the following figure best represents an age structure diagram for a population undergoing very rapid population growth?

 

 

 

 

 

173. Although nitrogen makes up almost 80% of

 

Earth’s atmosphere, nitrogen gas cannot be utilized by plants as a nitrogen source. What

biological process results in the conversion of nitrogen gas to a form useful to plants?

1. The conversion of nitrogen gas to nitrite by bacteria in a process called nitrification,
2. The conversion of nitrogen gas to ammonia by bacteria in a process called nitrogen fixation,
3. The conversion of nitrogen gas to ammonium by bacteria in a process called ammonification,
4. The conversion of nitrogen gas to nitric oxide by bacteria in a process called

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

174.      Which of the following pairs does NOT match?

1. Tropical rainforest – High species diversity,
2. Ozone shield depletion – Increased radiation reaching the surface of Earth,
3. Greenhouse effect – Rise in atmospheric CO2,
4. Eutrophication – Decreased net primary

 

 

 

 

 

175.      An individual’s fitness is best measured by:

1. Its ability to compete with other individuals for key resources,
2. Its resistance to disease and parasites,
3. Its ability to survive relative to other individuals,

 

1. Its relative contribution to the gene pool of the next

 

 

 

 

176.      Which statement best describes the difference between exponential and logistic growth?

1. Exponential growth depends on birth and death rates; logistic growth does not,
2. Emigration and immigration are not important for logistic growth and are important for exponential growth,
3. Exponential growth depends on density; logistic growth depends on the carrying capacity,
4. Logistic growth reflects density-dependent effects of birth and death rates; exponential growth is independent of

 

 

177.      Certain indigenous tribes in the Amazon tip the darts of their blowguns with poison derived from frogs. These frogs are often brilliantly colored and easy to spot in the forest. What is this an example of?

1. Batesian mimicry,
2. Warning coloration,
3. Müllerian mimicry,
4. Cryptic

 

 

 

 

 

178.      Imagine an animal that can alter its shape from a sphere to a ribbon. If this animal needs to conserve heat, it should form a:

1. Sphere, because this has a high surface area to volume ratio,
2. Sphere, because this has a low surface area to volume ratio,
3. Ribbon, because this has a high surface area to volume ratio,
4. Ribbon, because this has a low surface area to volume

 

 

179.      Energy enters an ecosystem via photosynthesis and moves up through the

ecosystem’s trophic levels. All this energy will be:

1. Used as fuel by the top predators in the ecosystem,
2. Converted into glucose by the primary producers,
3. Converted into heat; a type of energy unusable by life on Earth,
4. Converted into ATP, the molecule that provides energy for all organis

 

 

 

 

 

180.      During the Late Pleistocene in North America, pine trees (dark shading in the figure) colonized southern Ontario. This is an example of which biological process?

1. Adaptation to environment,
2. Translocation,
3. Succession,
4. Com

 

 

 

 

 

181.      Which statement about genetic disorders in humans is FALSE?

1. The frequency of the allele for sickle cell anemia is higher in native populations of wet, tropical countries because carriers have a better chance of surviving malaria,
2. Color blindness is rare in females because the condition is recessively inherited, and the gene is sex linked,
3. Down syndrome occurs when three copies of chromosome 21 are present,
4. Aneuploidies, such as Down syndrome, results from errors in DNA replication during the S phase.

 

182.      If a polypeptide was encoded by the following mRNA sequence how long (number of amino acids) would it be? (A table of the genetic code is also provided below.)

5′-CGAUGUUCCAAGUGAUGCAUAAAGAGUAGC-3′

 

 

1. 7,
2. 8,
3. 9,
4. 10.

 

 

 

 

 

 

183. If a molecule of mRNA, prior to splicing or polyadenylation, has 15% A, 20% G, 30% U, and 35% C, what is the composition of the double- stranded DNA that it was transcribed from?
184. 15% T, 20% C, 30% A, 35% G
185. 22.5% T, 22.5% A, 27.5% G, 27.5% C
186. 17.5% G, 17.5% A, 32.5% T, 32.5% C
187. 25% A, 25% C, 25% G, 25% T

 

 

 

 

 

184.      Which statement best describes why DNA replication is referred to as “semi- conservative”?

1. At each replication, each DNA molecule retains one strand intact and synthesizes the other strand from new m
2. After one round of replication, half of the DNA contains the original material and half is made up of new m
3. After two rounds of replication, all the DNA contains a mixture of original and new m
4. Within each strand, the number of purines equals the number of pyrim

 

 

 

 

 

 

 

 

A geneticist produced four plants with sickle-shaped pods and seven plants with crescent-shaped pods by crossing two plants of the same species. A review of the literature revealed that pod shape in this plant species is controlled by a single, completely dominant gene.

185. What is the most accurate conclusion that the geneticist can make about the genotype of the parental plants?
186. One parent was homozygous dominant and the other was homozygous recessive,
187. Both parents were
188. One parent was homozygous recessive and the other was
189. Since this result fits neither a 3:1 nor 1:1 distribution further cross is required to collect more

 

 

In the fruit fly Drosophila melanogaster, the white- eye allele is X-linked and recessive.

186. What would be the outcome of a cross between a white-eyed female and a red-eyed male?
187. The result would depend on the genotype of the parents,
188. All females will be red-eyed, and all males will be white-eyed,
189. All males will be white-eyed, and females will have a 1:1 red-eye to white-eye distribution,
190. Female to male distributions and red-eye to white-eye distributions will be 1:1, independent of one

 

 

 

 

187.  A man with blood type “A,” whose father was blood type “O,” married a woman of blood type “B” whose mother was blood type “O.” What are the possible blood types of their offspring?

1. Only A or B,
2. Only AB or O,

 

1. Only A, B, or AB,
2. A, B, AB, or

 

 

 

 

As part of a science competition, a student is asked to identify an unknown molecule as either DNA or RNA.

188. Which of the following characteristics would be the strongest evidence that the unknown molecule is DNA?
189. The presence of phosphate and sugar backbone,
190. The absence of uracil,
191. The presence of thymine,
192. The presence of adenine, guanine, and

 

 

 

 

 

In carnations, genes that code for flower color show an incomplete dominance relationship. Red flowers crossed with white flowers yield pink flowers.

189. What is the expected distribution of progeny from a cross between a pink- flowered parent and a red-flowered parent?
190. All red,
191. All pink,
192. 1:1 ratio of red to pink,
193. 1:1 ratio of red to white,

 

 

 

 

 

 

A drug company developed a new insecticide that is highly poisonous to mosquitoes carrying West Nile virus. Mass spraying of the insecticide over a 10- year period resulted in a significant reduction in mosquito populations over the first five years, and a gradual increase in mosquito populations over the next five years.

190. What is the most reasonable explanation for the observed effect of the insecticide on mosquito populations?
191. The insecticide caused favorable mutations in the mosquitoes that led to resistance,
192. Genetic variants of mosquitoes resistant to the insecticide survived and transmitted their resistance to their offspring,
193. The insecticide induced antibodies to the insecticide in some mosquitoes and these antibodies were then transmitted to offspring,
194. The drug company reduced the amount of insecticide sprayed in the environm

 

 

 

 

191.      Which statement about protein synthesis is CORRECT?

1. A mutation that suppresses the formation of small nuclear RNA (snRNA) would increase the average size of mRNAs,
2. Transcription factors act at the level of the ribosome during protein synthesis,
3. Introns contain tRNA sequences that fuse with rRNA to form spliceosomes,
4. Redundancy of the genetic code means that a single codon can code for more than one amino

 

 

 

 

Samples of DNA were obtained from a child, his mother, and four potential fathers (A, B, C, and D), and DNA fingerprinting was performed using two co-dominant loci.

192. Based on the resulting gels (below) who is the most likely father of the child?

 

 

 

 

1. Individual A,
2. Individual B,
3. Individual C,
4. Individual

 

 

A DNA restriction enzyme ‘recognizes’ the sequence TGAGA and cleaves a 5′ to 3′ strand between the two GAs. Single stranded DNA samples from a 20 bp locus from a crime scene and from four bank robber suspects are cleaved with the enzyme, and the fragments are run on an electrophoresis gel. The crime scene fragment is known to be: 5′ CACTGAGACCAGTTGAGAGC 3′.

193. Which suspect DNA profile below would produce a pattern on the gel most similar to the pattern at the crime scene?
194. 5′ GTCTGAGACTTCTGAGAATG 3′
195. 5′ AGTTTGAGAGTAGTGAGATG 3′
196. 5′ TCCATGAGACTTTTGAGATG 3′
197. 5′ CGGTGAATGAGATTGAGAGT 3′

 

 

 

 

 

194.      How does a ribosome interact with the cell’sgenetic material during

translation?

1. It enters the cell’s nucleus in order to directly

translate the cell’s DNA sequence into a sequence of amino acids.

1. A molecule of mRNA brings amino acids to the ribosome, which the ribosome then assembles into
2. A ribosome translates the amino acid sequence of a tRNA molecule into mRNA, which then assembles the
3. A ribosome translates the sequence of an mRNA molecule into a sequence of amino acids, which are retrieved by tRNA m

 

 

 

 

 

 

 

 

 

 

 

 

A plant scientist visited his mother and admired her

Azalea plant that was huge and had healthy dark green leaves. “But it never flowers”, his

mother complained.

195. What is the most likely reason why the plant did not flower?
     1. The plant needed more calcium,
     2. The plant had been given too much potassium,
     3. The plant does not receive enough light,
     4. The plant had been supplied with too much

 

 

 

 

 

A soluble red dye is injected into the phloem of a young plant about half-way up the stem. At the same time a yellow dye is injected into the xylem at the same height along the stem.

196. Which statement best explains where the two dyes will be found one day later?
     1. The tip of the plant (farthest from the soil) will contain only red dye; the tip of the root (deepest into the soil) only yellow dye,
     2. The tip of the plant will contain only yellow dye; the tip of the root only red dye,
     3. The tip of the plant will contain both red and yellow dye; the tip of the root only red dye,
     4. The tip of the plant will contain only red dye; the tip of the root both red and yellow dye,

 

A store placed a large basket of fruit containing oranges and unripe bananas by the cash register. There were too many bananas to fit in the basket, so they put the rest in the back room. The next day, the bananas in the basket had ripened, but the ones in the back room had not.

197. What is the most likely explanation?
     1. The oranges released gibberellins into the air, which triggered the bananas to ripen,
     2. The cytokinin in the oranges diffused into the bananas where the two fruits touched each other and triggered the bananas to ripen,
     3. The auxin in the oranges diffused into the bananas where the two fruits touched each other and triggered the bananas to ripen,
     4. The oranges had released ethylene into the air, which triggered the bananas to

 

 

You cut a live twig from a tree and examine the cut surface of the twig with a magnifying glass. You locate the vascular tissue and observe a growing droplet of fluid exuding from the cut surface.

198. Where is this fluid most likely to be from?
     1. Phloem,
     2. Xylem,
     3. Cork,

 

 

 

 

 

 

 

199.      Which statement about water transport in plants is FALSE?

1. Root pressure alone is insufficient to explain water transport in plants,
2. The amount of water that can be transported by vessels is a function of the radius of the transport vessels,
3. The transport of water is carried out by the xylem which consists of sieve-tube cells and companion cells,
4. Water movement in the xylem is largely due to the cohesive and adhesive properties of water.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Plants have adapted to a diversity of environments including arid environments such as deserts.

200. Which of the following traits is NOT an adaptation of plants to dry environments?
201. A photosynthetic system which allows the stomata to open only at night,
202. Low stomatal density,
203. A thick waxy cuticle,
204. A large leaf

 

 

 

 

A botanist is having difficulty getting seeds to germinate.

201. What hormone could she apply to the seeds to help induce germination?
     1. Auxin,
     2. Gibberellin,
     3. Abscisic acid,

 

 

 

 

Jack sold his cow for some bean seeds. He put the dry seeds in some damp soil and

noticed they didn’t grow. A friend told him he should soak them in

 

water in order to ‘wash out’ a certain plant growth hormone that was in high

concentration within the seed coat.

202. The hormone was which of the following?
     1. Ethylene,
     2. Gibberellin,
     3. Abscisic acid,
     4. Cytokinin.

 

 

 

 

 

203.      Which of the following is NOT shared by gymnosperms and angiosperms?

1. Seeds,
2. Pollen,
3. Ovaries,
4. Vascular

 

 

 

 

A molecule of carbon dioxide leaves a muscle cell in your leg and enters the blood in a capillary bed.

204. On its way to leaving the body via exhaled air which of the following structures will it NOT pass through?
205. The trachea,
206. An alveolus,
207. A pulmonary vein,
208. A vena